Review





Similar Products

86
Eurofins oligonucleotide primer sets
Oligonucleotide Primer Sets, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/oligonucleotide+primer+sets/pm41204960-34-4-23?v=Eurofins
Average 86 stars, based on 1 article reviews
oligonucleotide primer sets - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

90
Thermo Fisher oligonucleotide primer/probe sets mouse nrp1
Oligonucleotide Primer/Probe Sets Mouse Nrp1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/oligonucleotide+primer+sets/pmc11126613-292-2-16?v=Thermo+Fisher
Average 90 stars, based on 1 article reviews
oligonucleotide primer/probe sets mouse nrp1 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Bioneer Corporation oligonucleotide primer sets
Oligonucleotide Primer Sets, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/oligonucleotide+primer+sets/pmc09880262-66-1-11?v=Bioneer+Corporation
Average 90 stars, based on 1 article reviews
oligonucleotide primer sets - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
MdBio Inc oligonucleotide primer sets pbblamp conventional e. coli lamp reactions
Oligonucleotide Primer Sets Pbblamp Conventional E. Coli Lamp Reactions, supplied by MdBio Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/oligonucleotide+primer+sets/pm35926394-73-1-19?v=MdBio+Inc
Average 90 stars, based on 1 article reviews
oligonucleotide primer sets pbblamp conventional e. coli lamp reactions - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
MdBio Inc oligonucleotide primer sets for conventional e. coli lamp reactions
Oligonucleotide Primer Sets For Conventional E. Coli Lamp Reactions, supplied by MdBio Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/oligonucleotide+primer+sets/pm35926394-73-5-19?v=MdBio+Inc
Average 90 stars, based on 1 article reviews
oligonucleotide primer sets for conventional e. coli lamp reactions - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Metabion International AG primer set of 20 random decamer oligonucleotides
Primer Set Of 20 Random Decamer Oligonucleotides, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/oligonucleotide+primer+sets/pmc09020050-172-6-10?v=Metabion+International+AG
Average 90 stars, based on 1 article reviews
primer set of 20 random decamer oligonucleotides - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Thermo Fisher oligonucleotide primer sets for cyclin d1 promoter entire region
The principle ( A ) and results ( B , C ) of ELISA to validate fukutin binding to cyclin D1 promoter in total protein extracts obtained from 1321N1 cell lysate samples. ( A ) Prior to experiments, a microplate is coated with an anti-fukutin antibody. The antibody traps fukutin protein in the samples. Digoxigenin (DIG)-labeled <t>oligonucleotide</t> DNA probes, designated for the entire cyclin D1 promoter region and for the AP-1 binding site on the cyclin D1 promoter, are predicted to bind to the fukutin. Successful binding is detected with an alkaline phosphatase-labeled anti-DIG antibody and visualized using an enzyme reaction yellow product. The obtained values are subjected to statistical comparison. ( B ) The fukutin/entire promoter region complex levels are significantly increased in a manner dependent on cellular protein concentrations ( p < 0.0001 on one-way ANOVA). ( C ) The fukutin/AP-1 binding site complex levels are significantly increased in a manner dependent on cellular protein concentrations ( p < 0.0001 on one-way ANOVA). All experiments were conducted in triplicate.
Oligonucleotide Primer Sets For Cyclin D1 Promoter Entire Region, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/oligonucleotide+primer+sets/pmc08622492-163-0-30?v=Thermo+Fisher
Average 90 stars, based on 1 article reviews
oligonucleotide primer sets for cyclin d1 promoter entire region - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

Image Search Results


The principle ( A ) and results ( B , C ) of ELISA to validate fukutin binding to cyclin D1 promoter in total protein extracts obtained from 1321N1 cell lysate samples. ( A ) Prior to experiments, a microplate is coated with an anti-fukutin antibody. The antibody traps fukutin protein in the samples. Digoxigenin (DIG)-labeled oligonucleotide DNA probes, designated for the entire cyclin D1 promoter region and for the AP-1 binding site on the cyclin D1 promoter, are predicted to bind to the fukutin. Successful binding is detected with an alkaline phosphatase-labeled anti-DIG antibody and visualized using an enzyme reaction yellow product. The obtained values are subjected to statistical comparison. ( B ) The fukutin/entire promoter region complex levels are significantly increased in a manner dependent on cellular protein concentrations ( p < 0.0001 on one-way ANOVA). ( C ) The fukutin/AP-1 binding site complex levels are significantly increased in a manner dependent on cellular protein concentrations ( p < 0.0001 on one-way ANOVA). All experiments were conducted in triplicate.

Journal: International Journal of Molecular Sciences

Article Title: Fukutin Protein Participates in Cell Proliferation by Enhancing Cyclin D1 Expression through Binding to the Transcription Factor Activator Protein-1: An In Vitro Study

doi: 10.3390/ijms222212153

Figure Lengend Snippet: The principle ( A ) and results ( B , C ) of ELISA to validate fukutin binding to cyclin D1 promoter in total protein extracts obtained from 1321N1 cell lysate samples. ( A ) Prior to experiments, a microplate is coated with an anti-fukutin antibody. The antibody traps fukutin protein in the samples. Digoxigenin (DIG)-labeled oligonucleotide DNA probes, designated for the entire cyclin D1 promoter region and for the AP-1 binding site on the cyclin D1 promoter, are predicted to bind to the fukutin. Successful binding is detected with an alkaline phosphatase-labeled anti-DIG antibody and visualized using an enzyme reaction yellow product. The obtained values are subjected to statistical comparison. ( B ) The fukutin/entire promoter region complex levels are significantly increased in a manner dependent on cellular protein concentrations ( p < 0.0001 on one-way ANOVA). ( C ) The fukutin/AP-1 binding site complex levels are significantly increased in a manner dependent on cellular protein concentrations ( p < 0.0001 on one-way ANOVA). All experiments were conducted in triplicate.

Article Snippet: Oligonucleotide primer sets for cyclin D1 promoter entire region (sense, 5′–GTTTAATTGATAATTGTTCT–3′; antisense, 5′–CGGCTCTCGCTTCTGCTGCC–3′) and 5′-sided one-third portion of the cyclin D1 promoter region (sense, 5′–GTTTAATTGATAATTGTTCT–3′; antisense, 5′–AACCGGGAGAAACACACCTC–3′) were synthesized by Thermo Fisher Scientific.

Techniques: Enzyme-linked Immunosorbent Assay, Binding Assay, Labeling, Comparison